D16Mit5 Primer Detail MGI Mouse MGI:705464

D16Mit5 Primer Detail

Name

D16Mit5
Primer 1 Sequence

CGGGGATCATCCCTAAAAAC
Primer 2 Sequence

TCCCCAATTCCTCTTGTGTC
ID

MGI:705464
Product Size

156
Note

MIT assay: A38

D16Mit5

DNA segment, Chr 16, Massachusetts Institute of Technology 5

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit5	c	158bp	C3HeB/FeJLe
	D16Mit5	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit5	a	132bp	A/J, BALB/cJ, DBA/2J
	b	156bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	158bp	AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
	d	161bp	CAST/EiJ, SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit5	l	smaller	LG/J
	D16Mit5	s	larger	SM/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit5	c	larger	CBA/Kw
	D16Mit5	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24