About   Help   FAQ
D16Mit5 Primer Detail
Primers
  • Name
    D16Mit5
  • Primer 1 Sequence
    CGGGGATCATCCCTAAAAAC
  • Primer 2 Sequence
    TCCCCAATTCCTCTTGTGTC
  • ID
    MGI:705464
  • Product Size
    156
  • Note
    MIT assay: A38
Genes
D16Mit5 DNA segment, Chr 16, Massachusetts Institute of Technology 5
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit5 c 158bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit5 a 132bp A/J, BALB/cJ, DBA/2J
b 156bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 158bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
d 161bp CAST/EiJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D16Mit5 l smaller LG/J
s larger SM/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D16Mit5 c larger CBA/Kw
e smaller KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory