About   Help   FAQ
D16Mit4 Primer Detail
Primers
  • Name
    D16Mit4
  • Primer 1 Sequence
    AGTTCCAGGCTACTTGGGGT
  • Primer 2 Sequence
    GAGCCCTCATTGCAAATCAT
  • ID
    MGI:705462
  • Product Size
    132
  • Other IDs
    D16Mit4 (BROAD)
  • Note
    MIT assay: M203
    Additional information: MIT STS Marker Data Files
Genes
D16Mit4 DNA segment, Chr 16, Massachusetts Institute of Technology 4
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit4 b smaller than f C57BL/6J
c 123bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit4 a 123bp C3H/HeJ, DBA/2J
b 126bp AKR/J
c 130bp CAST/EiJ
d 132bp B6.Cg-Lepob/+, C57BL/6J
e 145bp SPRET/EiJ
f 147bp A/J
g 149bp BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D16Mit4 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D16Mit4 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit4 c 147bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory