D9Mit226 Primer Detail MGI Mouse MGI:705456

D9Mit226 Primer Detail

Name

D9Mit226
Primer 1 Sequence

ATAGGATAATTTATGGGTTCATTTGC
Primer 2 Sequence

GGAGTGGGAAGTTATGGCAA
ID

MGI:705456
Product Size

321
Other IDs

D9Mit226 (BROAD)
Note

MIT assay: MT3972
Additional information: MIT STS Marker Data Files

D9Mit226

DNA segment, Chr 9, Massachusetts Institute of Technology 226

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit226	a	314bp	AKR/J, DBA/2J, NOD/MrkTac
	b	322bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt, SPRET/EiJ
	c	332bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit226	a	332bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W
	b	322bp	C57BL/6W, C57BL/10W
	c	314bp	129/SvW, AKR/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24