About   Help   FAQ
D11Mit132 Primer Detail
Primers
  • Name
    D11Mit132
  • Primer 1 Sequence
    GGTCAGAGGACAATCTTACATGC
  • Primer 2 Sequence
    GTTCCAAGACAATGAGAGACCC
  • ID
    MGI:705441
  • Product Size
    117
  • Other IDs
    D11Mit132 (BROAD)
  • Note
    MIT assay: MMH359
    Additional information: MIT STS Marker Data Files
Genes
D11Mit132 DNA segment, Chr 11, Massachusetts Institute of Technology 132
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit132 a 107bp SPRET/EiJ
b 115bp BALB/cJ
c 117bp B6.Cg-Lepob/+, C57BL/6J
d 121bp AKR/J
e 123bp CAST/EiJ
f 125bp A/J
g 131bp C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit132 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory