About   Help   FAQ
D11Mit130 Primer Detail
Primers
  • Name
    D11Mit130
  • Primer 1 Sequence
    AGCATAAACAGATGTACATGCATATG
  • Primer 2 Sequence
    CAGGCCCAGAACTCATCTCT
  • ID
    MGI:705439
  • Product Size
    200
  • Other IDs
    D11Mit130 (BROAD)
  • Note
    MIT assay: MT707
    Additional information: MIT STS Marker Data Files
Genes
D11Mit130 DNA segment, Chr 11, Massachusetts Institute of Technology 130
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit130 a 216bp 129X1/Sv
f 196bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit130 a 195bp NOD/MrkTac
b 197bp AKR/J, DBA/2J
c 201bp C57BL/6J
d 203bp B6.Cg-Lepob/+, NON/ShiLt
e 205bp A/J, CAST/EiJ
f 209bp BALB/cJ, SPRET/EiJ
g 213bp LP/J
h 215bp C3H/HeJ
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit130 c upper CBA/Kw
k lower KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory