D15Mit90 Primer Detail MGI Mouse MGI:705436

D15Mit90 Primer Detail

Name

D15Mit90
Primer 1 Sequence

TGGTGTCCAAGTGTGCCTT
Primer 2 Sequence

CTTTCTGCCTCTCTCTCTCTCG
ID

MGI:705436
Product Size

115
Other IDs

D15Mit90 (BROAD)
Note

MIT assay: MPC2104
Additional information: MIT STS Marker Data Files

D15Mit90

DNA segment, Chr 15, Massachusetts Institute of Technology 90

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit90	a	113bp	129X1/Sv
Not Specified	D15Mit90	f	109, 113bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit90	a	91bp	DBA/2J
	b	93bp	NON/ShiLt
	c	103bp	CAST/EiJ
	d	109bp	BALB/cJ, NOD/MrkTac, SPRET/EiJ
	e	113bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24