About   Help   FAQ
D15Mit90 Primer Detail
Primers
  • Name
    D15Mit90
  • Primer 1 Sequence
    TGGTGTCCAAGTGTGCCTT
  • Primer 2 Sequence
    CTTTCTGCCTCTCTCTCTCTCG
  • ID
    MGI:705436
  • Product Size
    115
  • Other IDs
    D15Mit90 (BROAD)
  • Note
    MIT assay: MPC2104
    Additional information: MIT STS Marker Data Files
Genes
D15Mit90 DNA segment, Chr 15, Massachusetts Institute of Technology 90
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit90 a 113bp 129X1/Sv
f 109, 113bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit90 a 91bp DBA/2J
b 93bp NON/ShiLt
c 103bp CAST/EiJ
d 109bp BALB/cJ, NOD/MrkTac, SPRET/EiJ
e 113bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory