D13Mit88 Primer Detail MGI Mouse MGI:705398

D13Mit88 Primer Detail

Name

D13Mit88
Primer 1 Sequence

ACTGATGGCTCATGAGACCC
Primer 2 Sequence

AAAATTAATAGGAACTGCAAGGG
ID

MGI:705398
Product Size

169
Other IDs

D13Mit88 (BROAD)
Note

MIT assay: MPC2549
Additional information: MIT STS Marker Data Files

D13Mit88

DNA segment, Chr 13, Massachusetts Institute of Technology 88

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit88	a	170bp	129X1/Sv
Not Specified	D13Mit88	f	176bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit88	a	134bp	SPRET/EiJ
	b	168bp	NON/ShiLt
	c	170bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	d	176bp	AKR/J
	e	180bp	BALB/cJ, LP/J
	f	182bp	A/J
	g	194bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D13Mit88	a	180bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W
	b	176bp	AKR/W
	c	170bp	129/SvW, C57BL/6W, C57BL/10W, DBA/2W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23