About   Help   FAQ
D13Mit88 Primer Detail
Primers
  • Name
    D13Mit88
  • Primer 1 Sequence
    ACTGATGGCTCATGAGACCC
  • Primer 2 Sequence
    AAAATTAATAGGAACTGCAAGGG
  • ID
    MGI:705398
  • Product Size
    169
  • Other IDs
    D13Mit88 (BROAD)
  • Note
    MIT assay: MPC2549
    Additional information: MIT STS Marker Data Files
Genes
D13Mit88 DNA segment, Chr 13, Massachusetts Institute of Technology 88
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit88 a 170bp 129X1/Sv
f 176bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit88 a 134bp SPRET/EiJ
b 168bp NON/ShiLt
c 170bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
d 176bp AKR/J
e 180bp BALB/cJ, LP/J
f 182bp A/J
g 194bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D13Mit88 a 180bp A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W
b 176bp AKR/W
c 170bp 129/SvW, C57BL/6W, C57BL/10W, DBA/2W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory