About   Help   FAQ
D17Mit52 Primer Detail
Primers
  • Name
    D17Mit52
  • Primer 1 Sequence
    TCTGCCCTGTAACAGGAGCT
  • Primer 2 Sequence
    CTTCTGGAATCAGAGGATCCC
  • ID
    MGI:705392
  • Product Size
    154
  • Note
    MIT assay: B525
Genes
D17Mit52 DNA segment, Chr 17, Massachusetts Institute of Technology 52
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit52 a large STOCK t12
b larger STOCK tw5
c smallest C3H, STOCK tw12
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit52 a 132bp 129X1/Sv
f 124, 128, 132bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit52 a 134bp SPRET/EiJ
b 140bp AKR/J, C3H/HeJ
c 150bp A/J
d 152bp DBA/2J, NOD/MrkTac, NON/ShiLt
e 154bp B6.Cg-Lepob/+, C57BL/6J
f 156bp BALB/cJ
g 162bp CAST/EiJ, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit52 c 143bp CBA/CaOlaHsd
s 142bp SWR/OlaHsd
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory