About   Help   FAQ
D17Mit50 Primer Detail
Primers
  • Name
    D17Mit50
  • Primer 1 Sequence
    AGTCAAACCCAGGTCCTCTG
  • Primer 2 Sequence
    CAATTAAGCAGTAGTGGTGATGC
  • ID
    MGI:705390
  • Product Size
    124
  • Other IDs
    D17Mit50 (BROAD)
  • Note
    MIT assay: B619
    Additional information: MIT STS Marker Data Files
Genes
D17Mit50 DNA segment, Chr 17, Massachusetts Institute of Technology 50
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit50 a 114bp AKR/J, BALB/cJ, C3H/HeJ
b 118bp A/J
c 122bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac, SPRET/EiJ
d 124bp LP/J
e 134bp NON/ShiLt
f 156bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit50 b 125bp C57BL/6JOlaHsd
c 113bp 129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ
d 119bp A/JOlaHsd, DBA/2J
j 133bp JF1
l 135bp C57BL/10, SJL/J
p 139bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory