D17Mit57 Primer Detail MGI Mouse MGI:705387

D17Mit57 Primer Detail

Name

D17Mit57
Primer 1 Sequence

GCTGATAAACGTGGTGGCTT
Primer 2 Sequence

GTTTAGTGGCTTCAAGTCACCC
ID

MGI:705387
Product Size

300
Other IDs

D17Mit57 (BROAD)
Note

MIT assay: MPC1689
Additional information: MIT STS Marker Data Files

D17Mit57

DNA segment, Chr 17, Massachusetts Institute of Technology 57

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit57	c	320bp	BALB/cJ
Not Specified	D17Mit57	s	300bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit57	a	300bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	320bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	330bp	CAST/EiJ

J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit57	b	smaller	C57BL/6J
	D17Mit57	l	larger	C57L/J

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24