About   Help   FAQ
D17Mit57 Primer Detail
Primers
  • Name
    D17Mit57
  • Primer 1 Sequence
    GCTGATAAACGTGGTGGCTT
  • Primer 2 Sequence
    GTTTAGTGGCTTCAAGTCACCC
  • ID
    MGI:705387
  • Product Size
    300
  • Other IDs
    D17Mit57 (BROAD)
  • Note
    MIT assay: MPC1689
    Additional information: MIT STS Marker Data Files
Genes
D17Mit57 DNA segment, Chr 17, Massachusetts Institute of Technology 57
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit57 c 320bp BALB/cJ
s 300bp 129X1/SvJ, C57BL/6J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit57 a 300bp B6.Cg-Lepob/+, C57BL/6J
b 320bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 330bp CAST/EiJ
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit57 b smaller C57BL/6J
l larger C57L/J
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory