About   Help   FAQ
D12Mit109 Primer Detail
Primers
  • Name
    D12Mit109
  • Primer 1 Sequence
    AGGCCAGGTCACCAAAAAC
  • Primer 2 Sequence
    TTATGCTGGACAGATATGGGC
  • ID
    MGI:705369
  • Product Size
    124
  • Other IDs
    D12Mit109 (BROAD)
  • Note
    MIT assay: MT135
    Additional information: MIT STS Marker Data Files
Genes
D12Mit109 DNA segment, Chr 12, Massachusetts Institute of Technology 109
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit109 a 106bp SPRET/EiJ
b 124bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
c 128bp NON/ShiLt
d 130bp DBA/2J
e 132bp LP/J, NOD/MrkTac
f 140bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit109 c 122bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/14/2024
MGI 6.23 		The Jackson Laboratory