About   Help   FAQ
D5Mit356 Primer Detail
Primers
  • Name
    D5Mit356
  • Primer 1 Sequence
    CCATGCCCAGTCTGGTATCT
  • Primer 2 Sequence
    TTTTACTTTCCACTAAGCATTCCC
  • ID
    MGI:705366
  • Product Size
    124
  • Other IDs
    D5Mit356 (BROAD)
  • Note
    MIT assay: MTH2090
    Additional information: MIT STS Marker Data Files
Genes
D5Mit356 DNA Segment, Chr 5, Massachusetts Institute of Technology 356
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit356 a 110bp A/J, AKR/J, BALB/cJ, LP/J
b 124bp C57BL/6J, SPRET/EiJ
c 146bp C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 160bp CAST/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit356 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory