About   Help   FAQ
D4Mit203 Primer Detail
Primers
  • Name
    D4Mit203
  • Primer 1 Sequence
    GAATTCTTCCTGGGCCTTTC
  • Primer 2 Sequence
    CAAGAGCCCAGGTGTGGTAT
  • ID
    MGI:705337
  • Product Size
    105
  • Other IDs
    D4Mit203 (BROAD)
  • Note
    MIT assay: MT2589
    Additional information: MIT STS Marker Data Files
Genes
D4Mit203 DNA segment, Chr 4, Massachusetts Institute of Technology 203
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit203 a 89bp CAST/EiJ
b 102bp LP/J
c 106bp B6.Cg-Lepob/+
d 112bp NOD/MrkTac
e 118bp A/J, AKR/J, BALB/cJ, DBA/2J
f 122bp SPRET/EiJ
g 124bp C3H/HeJ, NON/ShiLt
h 144bp C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D4Mit203 b 103bp C57BL/6JOlaHsd, JF1
d 113bp AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
l 115bp SJL/J
p 101bp 129P3/J, C57BL/10, PWB
w 111bp A/JOlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit203 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory