About   Help   FAQ
D7Mit10 Primer Detail
Primers
  • Name
    D7Mit10
  • Primer 1 Sequence
    GAAGATTGGGCTGTCTGCAC
  • Primer 2 Sequence
    TGAAGCTGATGGAGCTGATG
  • ID
    MGI:705320
  • Product Size
    150
  • Other IDs
    D7Mit10 (BROAD)
  • Note
    MIT assay: L25
    Additional information: MIT STS Marker Data Files
Genes
D7Mit10 DNA segment, Chr 7, Massachusetts Institute of Technology 10
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit10 a 147bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 154bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D7Mit10 l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory