D7Mit16 Primer Detail MGI Mouse MGI:705314

D7Mit16 Primer Detail

Name

D7Mit16
Primer 1 Sequence

CTGGTCTCTGTCCTTGGAGC
Primer 2 Sequence

AAAGAAAATATTCTTGTTGCCAGC
ID

MGI:705314
Product Size

241
Other IDs

D7Mit16 (BROAD)
Note

MIT assay: A13
Additional information: MIT STS Marker Data Files

DNA segment, Chr 9, Massachusetts Institute of Technology 1004

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit1004	a	largest	C57BL/6, DBA/2
Not Specified	D9Mit1004	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit1004	a	243bp	B6.Cg-Lep^ob/+
	D9Mit1004	b	246bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit1004	l	smaller	LG/J
	D9Mit1004	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24