About   Help   FAQ
D7Mit17 Primer Detail
Primers
  • Name
    D7Mit17
  • Primer 1 Sequence
    CTGGCATTTATGTTGCTTCA
  • Primer 2 Sequence
    AACTTGCCTTCTGTCCTCCA
  • ID
    MGI:705313
  • Product Size
    161
  • Other IDs
    D7Mit17 (BROAD)
  • Note
    MIT assay: M91
    Additional information: MIT STS Marker Data Files
Genes
D7Mit17 DNA segment, Chr 7, Massachusetts Institute of Technology 17
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit17 m 160bp MOLF/EiJ
s 155bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit17 a 144bp CAST/EiJ, NOD/MrkTac
b 160bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
c 162bp C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 170bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D7Mit17 l larger LG/J
s smaller SM/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory