About   Help   FAQ
D8Mit200 Primer Detail
Primers
  • Name
    D8Mit200
  • Primer 1 Sequence
    GCAGTACCTTGTCTAAGAATTAGAAGC
  • Primer 2 Sequence
    TGCTGCTGATGTTGATGTTG
  • ID
    MGI:705311
  • Product Size
    195
  • Other IDs
    D8Mit200 (BROAD)
  • Note
    MIT assay: MT2342
    Additional information: MIT STS Marker Data Files
Genes
D8Mit200 DNA segment, Chr 8, Massachusetts Institute of Technology 200
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit200 b 0.197kb B10.D2-H2d, C57BL/6
c 0.215kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit200 a 201bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 207bp 129X1/SvJ
c 197, 201, 207bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit200 a 197bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
b 201bp LP/J, SPRET/EiJ
c 211bp BALB/cJ
d 215bp A/J, AKR/J, DBA/2J
e 217bp C3H/HeJ
f 233bp CAST/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory