About   Help   FAQ
D8Mit205 Primer Detail
Primers
  • Name
    D8Mit205
  • Primer 1 Sequence
    TTTGACTGCATTGACATTCTCC
  • Primer 2 Sequence
    GAGAAGAAGGCACAGAGTTTGG
  • ID
    MGI:705308
  • Product Size
    141
  • Other IDs
    D8Mit205 (BROAD)
  • Note
    MIT assay: MT3052
    Additional information: MIT STS Marker Data Files
Genes
D8Mit205 DNA segment, Chr 8, Massachusetts Institute of Technology 205
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit205 a 124bp SPRET/EiJ
b 138bp A/J
c 144bp BALB/cJ, LP/J, NOD/MrkTac
d 146bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
e 158bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit205 c 159bp CBA/CaOlaHsd
s 135bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory