About   Help   FAQ
D8Mit209 Primer Detail
Primers
  • Name
    D8Mit209
  • Primer 1 Sequence
    CTGAACCCAGGCTGTTGAGT
  • Primer 2 Sequence
    AGAGCCTGGACACACACACA
  • ID
    MGI:705306
  • Product Size
    144
  • Other IDs
    D8Mit209 (BROAD)
  • Note
    MIT assay: MT3188
    Additional information: MIT STS Marker Data Files
Genes
D8Mit209 DNA segment, Chr 8, Massachusetts Institute of Technology 209
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit209 a 120bp LP/J
b 128bp SPRET/EiJ
c 136bp NON/ShiLt
d 138bp CAST/EiJ
e 148bp A/J, C3H/HeJ, C57BL/6J
f 150bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, DBA/2J, NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit209 c 145bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory