About   Help   FAQ
D19Mit119 Primer Detail
Primers
  • Name
    D19Mit119
  • Primer 1 Sequence
    CACCCACATACCTTGATT
  • Primer 2 Sequence
    CTCTCTTTATCTCTCCTCTCTCT
  • ID
    MGI:705305
  • Product Size
    260
  • Other IDs
    D19Mit119 (BROAD)
  • Note
    MIT assay: MTH2706
    Additional information: MIT STS Marker Data Files
Genes
D19Mit119 DNA Segment, Chr 19 Massachusetts Institute of Technology 119
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit119 a 281bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv, CD-1
b 275bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit119 a 264bp B6.Cg-Lepob/+
b 265bp C57BL/6J
c 276bp C3H/HeJ, DBA/2J
d 281bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
e 283bp A/J, BALB/cJ
f 287bp CAST/EiJ, SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit119 c smaller CBA/Kw
e larger KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory