About   Help   FAQ
D19Mit40 Primer Detail
Primers
  • Name
    D19Mit40
  • Primer 1 Sequence
    CAGGGTAGTATTGCAGATAATCAA
  • Primer 2 Sequence
    AAAGTTTCTTTGTGTGTGCACG
  • ID
    MGI:705296
  • Product Size
    112
  • Other IDs
    D19Mit40 (BROAD)
  • Note
    MIT assay: MPC996
    Additional information: MIT STS Marker Data Files
Genes
D19Mit40 DNA segment, Chr 19, Massachusetts Institute of Technology 40
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit40 a 112bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 108bp 129X1/SvJ
c 102, 112bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit40 c 106bp C3HeB/FeJLe
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit40 m 93bp MOLF/EiJ
s 117bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit40 a 96bp SPRET/EiJ
b 102bp A/J, BALB/cJ
c 106bp C3H/HeJ, DBA/2J
d 111bp CAST/EiJ
e 112bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
f 114bp NON/ShiLt
g 122bp AKR/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit40 c 104bp CBA/CaOlaHsd
s 112bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit40 c smaller CBA/Kw
e larger KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory