About   Help   FAQ
D19Mit46 Primer Detail
Primers
  • Name
    D19Mit46
  • Primer 1 Sequence
    ACCCTGCCCTCTCTCTCC
  • Primer 2 Sequence
    GCACTCGCCAACTCAGGTAT
  • ID
    MGI:705294
  • Product Size
    113
  • Other IDs
    D19Mit46 (BROAD)
  • Note
    MIT assay: MMH224
    Additional information: MIT STS Marker Data Files
Genes
D19Mit46 DNA segment, Chr 19, Massachusetts Institute of Technology 46
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit46 m 130bp MOLF/EiJ
s 117bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit46 a 115bp C57BL/6J
b 117bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
c 119bp B6.Cg-Lepob/+
d 123bp C3H/HeJ, DBA/2J
e 129bp BALB/cJ
f 133bp A/J
g 143bp CAST/EiJ
h 195bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D19Mit46 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit46 c 122bp CBA/CaOlaHsd
s 113bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory