About   Help   FAQ
D19Mit45 Primer Detail
Primers
  • Name
    D19Mit45
  • Primer 1 Sequence
    CCATTCATAAAATGGGCTTAGG
  • Primer 2 Sequence
    ACCATGAATGTGTTTTGAGGTG
  • ID
    MGI:705293
  • Product Size
    145
  • Other IDs
    D19Mit45 (BROAD)
  • Note
    MIT assay: MPC2246
    Additional information: MIT STS Marker Data Files
Genes
D19Mit45 DNA segment, Chr 19, Massachusetts Institute of Technology 45
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit45 a 143bp 129X1/Sv
f 137, 143, 147bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit45 a 137bp C3H/HeJ, DBA/2J, NOD/MrkTac
b 143bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
c 147bp A/J, AKR/J, BALB/cJ, LP/J, NON/ShiLt
d 149bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory