D5Mit348 Primer Detail MGI Mouse MGI:705275

D5Mit348 Primer Detail

Name

D5Mit348
Primer 1 Sequence

CTGACCAGAACACAGCATAGTACA
Primer 2 Sequence

TTTAAAATAGGAAAAGCATTCTTTCC
ID

MGI:705275
Product Size

123
Other IDs

D5Mit348 (BROAD)
Note

MIT assay: MTH1402
Additional information: MIT STS Marker Data Files

D5Mit348

DNA Segment, Chr 5, Massachusetts Institute of Technology 348

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit348	a	109bp	CAST/EiJ
	b	111bp	LP/J
	c	115bp	DBA/2J, NOD/MrkTac
	d	119bp	SPRET/EiJ
	e	123bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt
	f	133bp	A/J, AKR/J, C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit348	a	130bp	A.CA/W, AKR/W, C3H/W, CBA/W
	b	123bp	129/SvW, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	c	115bp	DBA/2W

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit348	c	upper	CBA/Kw
	D5Mit348	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23