About   Help   FAQ
D5Mit348 Primer Detail
Primers
  • Name
    D5Mit348
  • Primer 1 Sequence
    CTGACCAGAACACAGCATAGTACA
  • Primer 2 Sequence
    TTTAAAATAGGAAAAGCATTCTTTCC
  • ID
    MGI:705275
  • Product Size
    123
  • Other IDs
    D5Mit348 (BROAD)
  • Note
    MIT assay: MTH1402
    Additional information: MIT STS Marker Data Files
Genes
D5Mit348 DNA Segment, Chr 5, Massachusetts Institute of Technology 348
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit348 a 109bp CAST/EiJ
b 111bp LP/J
c 115bp DBA/2J, NOD/MrkTac
d 119bp SPRET/EiJ
e 123bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
f 133bp A/J, AKR/J, C3H/HeJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit348 a 130bp A.CA/W, AKR/W, C3H/W, CBA/W
b 123bp 129/SvW, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
c 115bp DBA/2W
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit348 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory