D16Mit64 Primer Detail MGI Mouse MGI:705274

D16Mit64 Primer Detail

Name

D16Mit64
Primer 1 Sequence

TACCATGATCAGTCCAAAGGC
Primer 2 Sequence

ACTTAAGGTTGTCCTGTGGGG
ID

MGI:705274
Product Size

220
Other IDs

D16Mit64 (BROAD)
Note

MIT assay: MPC2483
Additional information: MIT STS Marker Data Files

D16Mit64

DNA segment, Chr 16, Massachusetts Institute of Technology 64

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D16Mit64	b	larger than f	C57BL/6J
	c	218bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit64	a	210bp	NON/ShiLt
	b	218bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	c	230bp	A/J, BALB/cJ, DBA/2J, LP/J
	d	244bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24