About   Help   FAQ
D2Mit311 Primer Detail
Primers
  • Name
    D2Mit311
  • Primer 1 Sequence
    ACAGGCAGCCTTCCCTTC
  • Primer 2 Sequence
    TCTGTCCCGCTTCTGTTTCT
  • ID
    MGI:705247
  • Product Size
    126
  • Other IDs
    D2Mit311 (BROAD)
  • Note
    MIT assay: MT3522
    Additional information: MIT STS Marker Data Files
Genes
D2Mit311 DNA segment, Chr 2, Massachusetts Institute of Technology 311
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit311 a 122bp 129X1/Sv
f 108, 114, 128bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit311 a 108bp AKR/J, C3H/HeJ, DBA/2J
b 114bp A/J, BALB/cJ, CAST/EiJ, NOD/MrkTac
c 116bp SPRET/EiJ
d 122bp LP/J
e 128bp B6.Cg-Lepob/+, C57BL/6J
f 134bp NON/ShiLt
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory