DXMit41 Primer Detail MGI Mouse MGI:705238

DXMit41 Primer Detail

Name

DXMit41
Primer 1 Sequence

AAGCATTTATCATCATCATGATCG
Primer 2 Sequence

AGTCTGAGTTCTAACCATGAACCC
ID

MGI:705238
Product Size

192
Other IDs

DXMit41 (BROAD)
Note

MIT assay: MPC1132
Additional information: MIT STS Marker Data Files

DXMit41

DNA segment, Chr X, Massachusetts Institute of Technology 41

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit41	m	241bp	MOLF/EiJ
Not Specified	DXMit41	s	201bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit41	a	194bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	b	198bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	c	200bp	SPRET/EiJ
	d	250bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24