D2Mit53 Primer Detail MGI Mouse MGI:705230

D2Mit53 Primer Detail

Name

D2Mit53
Primer 1 Sequence

GTGGACATTCCCTGAGAAACA
Primer 2 Sequence

GGGGTTTGATCAGCTCATGT
ID

MGI:705230
Product Size

148
Other IDs

D2Mit53 (BROAD)
Note

MIT assay: B342
Additional information: MIT STS Marker Data Files

D2Mit53

DNA segment, Chr 2, Massachusetts Institute of Technology 53

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit53	c	150bp	C3HeB/FeJLe
	D2Mit53	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit53	a	142bp	NON/ShiLt
	b	148bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac
	c	150bp	C3H/HeJ, DBA/2J
	d	152bp	CAST/EiJ, SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24