About   Help   FAQ
D14Mit132 Primer Detail
Primers
  • Name
    D14Mit132
  • Primer 1 Sequence
    GAACAGCACCATCCACACAC
  • Primer 2 Sequence
    GTGGGGTTATATGCAGATACTCG
  • ID
    MGI:705205
  • Product Size
    132
  • Other IDs
    D14Mit132 (BROAD)
  • Note
    MIT assay: MT324
    Additional information: MIT STS Marker Data Files
Genes
D14Mit132 DNA segment, Chr 14, Massachusetts Institute of Technology 132
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit132 a 108bp SPRET/EiJ
b 127bp LP/J
c 131bp CAST/EiJ
d 133bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit132 c 133bp CBA/CaOlaHsd
s 126bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory