About   Help   FAQ
D10Mit70 Primer Detail
Primers
  • Name
    D10Mit70
  • Primer 1 Sequence
    ACCTTTCTTCCTACCTACCTACCT
  • Primer 2 Sequence
    TGGCACTTAGAAACTGATAAATGG
  • ID
    MGI:705196
  • Product Size
    145
  • Other IDs
    D10Mit70 (BROAD)
  • Note
    MIT assay: MPC640
    Additional information: MIT STS Marker Data Files
Genes
D10Mit70 DNA segment, Chr 10, Massachusetts Institute of Technology 70
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit70 a 144bp B6.Cg-Lepob/+, C57BL/6J
b 148bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 154bp CAST/EiJ
d 176bp A/J, BALB/cJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit70 a 188bp A.CA/W, BALB/cW, DBA/2W
b 156bp AKR/W, BN/aW, C3H/W, CBA/W
c 150bp 129/SvW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory