About   Help   FAQ
D14Mit42 Primer Detail
Primers
  • Name
    D14Mit42
  • Primer 1 Sequence
    GTGTCACTTTCTCCCTGTGAG
  • Primer 2 Sequence
    TTATACACATGTACATGCATGCA
  • ID
    MGI:705188
  • Product Size
    150
  • Note
    MIT assay: M174
Genes
D14Mit42 DNA segment, Chr 14, Massachusetts Institute of Technology 42
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit42 m 160bp MOLF/EiJ
s 152bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit42 a 142bp LP/J
b 150bp DBA/2J
c 152bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 168bp SPRET/EiJ
e 176bp CAST/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory