About   Help   FAQ
D14Mit44 Primer Detail
Primers
  • Name
    D14Mit44
  • Primer 1 Sequence
    AGTCACACCTGTAGAGTAAGCACA
  • Primer 2 Sequence
    GCTACTGCCTCGGTTTGTG
  • ID
    MGI:705186
  • Product Size
    149
  • Other IDs
    D14Mit44 (BROAD)
  • Note
    MIT assay: B689
    Additional information: MIT STS Marker Data Files
Genes
D14Mit44 DNA segment, Chr 14, Massachusetts Institute of Technology 44
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D14Mit44 c 148bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit44 a 144bp NON/ShiLt
b 148bp A/J, AKR/J, BALB/cJ, C3H/HeJ
c 150bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
d 152bp LP/J
e 160bp NOD/MrkTac
f 172bp CAST/EiJ
g 180bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit44 c 148bp CBA/CaOlaHsd
s 144bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory