D1Mit3 Primer Detail MGI Mouse MGI:705177

D1Mit3 Primer Detail

Name

D1Mit3
Primer 1 Sequence

TTTTTGTTTTCTTTTCTTTTCCC
Primer 2 Sequence

CCCTCTTCTGGTTTCCACAT
ID

MGI:705177
Product Size

160
Other IDs

D1Mit3 (BROAD)
Note

MIT assay: M253
Additional information: MIT STS Marker Data Files

D1Mit3

DNA segment, Chr 1, Massachusetts Institute of Technology 3

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit3	b	smaller	C57BL/6J
	D1Mit3	f	larger	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit3	a	largest	JF1
		b	smaller	DBA/2
		c	smallest	C57BL/6, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit3	a	160bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	b	185bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NOD/MrkTac, NON/ShiLt
	c	187bp	LP/J
	d	200bp	SPRET/EiJ
	e	206bp	AKR/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit3	l	larger	LG/J
	D1Mit3	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D1Mit3	a	206bp	AKR/W
	b	185bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W
	c	160bp	C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit3	c	lower	CBA/Kw
	D1Mit3	e	upper	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24