About   Help   FAQ
D1Mit458 Primer Detail
Primers
  • Name
    D1Mit458
  • Primer 1 Sequence
    AAAAAAAGTAAAAAGGGGCAGG
  • Primer 2 Sequence
    CCAGTACAGTTAGAGATTTAAAACACA
  • ID
    MGI:705161
  • Product Size
    100
  • Other IDs
    D1Mit458 (BROAD)
  • Note
    MIT assay: MTH1408
    Additional information: MIT STS Marker Data Files
Genes
D1Mit458 DNA Segment, Chr 1, Massachusetts Institute of Technology 458
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit458 a 96bp A/J, NOD/MrkTac
b 100bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 126bp CAST/EiJ
d 138bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit458 c 162bp CBA/CaOlaHsd
s 155bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory