D9Mit90 Primer Detail MGI Mouse MGI:705111

D9Mit90 Primer Detail

Name

D9Mit90
Primer 1 Sequence

AGGAGTCTCCCTGTACCTACACC
Primer 2 Sequence

AAGTAGAGGGGAGGAATGAACC
ID

MGI:705111
Product Size

140
Other IDs

D9Mit90 (BROAD)
Note

MIT assay: MT89
Additional information: MIT STS Marker Data Files

D9Mit90

DNA segment, Chr 9, Massachusetts Institute of Technology 90

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit90	c	143bp	C3HeB/FeJLe
	D9Mit90	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit90	a	131bp	SPRET/EiJ
	b	143bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NOD/MrkTac
	c	145bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	147bp	NON/ShiLt
	e	159bp	DBA/2J, LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit90	c	178bp	CBA/CaOlaHsd
	D9Mit90	s	175bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/09/2025 MGI 6.24