About   Help   FAQ
D10Mit198 Primer Detail
Primers
  • Name
    D10Mit198
  • Primer 1 Sequence
    CATGTTTCTCTAGCCACCTGC
  • Primer 2 Sequence
    TCCAGCCTTTGAGGTAGCC
  • ID
    MGI:705107
  • Product Size
    131
  • Other IDs
    D10Mit198 (BROAD)
  • Note
    MIT assay: MT2170
    Additional information: MIT STS Marker Data Files
Genes
D9Mit1006 DNA segment, Chr 9, Massachusetts Institute of Technology 1006
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit1006 b smaller C57BL/6J
c 166bp C3HeB/FeJLe
f smallest FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit1006 a 133bp CAST/EiJ
b 145bp B6.Cg-Lepob/+
c 159bp C57BL/6J
d 166bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
e 170bp AKR/J, NOD/MrkTac, NON/ShiLt
f 174bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit1006 a 132bp AKR/OlaHsd, C57BL/6JOlaHsd
d 140bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, C57BL/10, DBA/2J, SJL/J
j 148bp JF1
p 144bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit1006 c 137bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory