D17Mit129 Primer Detail MGI Mouse MGI:705097

D17Mit129 Primer Detail

Name

D17Mit129
Primer 1 Sequence

TGTTGATTTCTGGTGTCCACA
Primer 2 Sequence

GACAGGTTGAGCAACTCATCTG
ID

MGI:705097
Product Size

149
Other IDs

D17Mit129 (BROAD)
Note

MIT assay: MT1311
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 129

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit129	a	149bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	145bp	129X1/SvJ
		c	139, 149bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit129	a	139bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	b	143bp	AKR/J
	c	145bp	CAST/EiJ
	d	147bp	NOD/MrkTac, SPRET/EiJ
	e	149bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit129	c	smaller	CBA/Kw
	D17Mit129	e	larger	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13