About   Help   FAQ
D17Mit128 Primer Detail
Primers
  • Name
    D17Mit128
  • Primer 1 Sequence
    TGTCTGCCCCCTCTCATTC
  • Primer 2 Sequence
    TTAACTGTGTCTTGTATCCCATGG
  • ID
    MGI:705096
  • Product Size
    146
  • Other IDs
    D17Mit128 (BROAD)
  • Note
    MIT assay: MT1134
    Additional information: MIT STS Marker Data Files
Genes
D17Mit128 DNA segment, Chr 17, Massachusetts Institute of Technology 128
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit128 a 133bp BALB/cJ
b 143bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 145bp A/J, C3H/HeJ, DBA/2J
d 157bp CAST/EiJ
e 161bp SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D17Mit128 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory