About   Help   FAQ
D17Mit126 Primer Detail
Primers
  • Name
    D17Mit126
  • Primer 1 Sequence
    TATGTGGCATCTCTTTATTCATGA
  • Primer 2 Sequence
    GCCAAGGATTGTCTGCCTTA
  • ID
    MGI:705094
  • Product Size
    137
  • Other IDs
    D17Mit126 (BROAD)
  • Note
    MIT assay: MT1224
    Additional information: MIT STS Marker Data Files
Genes
D17Mit126 DNA segment, Chr 17, Massachusetts Institute of Technology 126
Polymorphisms
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit126 a small B10.CAS3, B10.CAS4
b medium C3H/HeJ
c large C3.SW-H2b, C57BL/6, C57BL/10
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit126 a smallest M. spretus
b larger CAST/EiJ, CBA/J
c larger than above A.CA-H2f/Sn
d larger than above C57BL/6J, DBA/2J, P/J, SJL/J, SM/J, SWR/J
e larger than above RIIIS/J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit126 a 125bp SPRET/EiJ
b 129bp AKR/J, C3H/HeJ, CAST/EiJ
c 137bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit126 a 137bp 129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
b 129bp AKR/W, BN/aW, C3H/W, CBA/W
References
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory