D17Mit125 Primer Detail MGI Mouse MGI:705093

D17Mit125 Primer Detail

Name

D17Mit125
Primer 1 Sequence

GGATTCCACAGGCATTGC
Primer 2 Sequence

TCCTGACTACCCCCAACTTG
ID

MGI:705093
Product Size

143
Other IDs

D17Mit125 (BROAD)
Note

MIT assay: MT972
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 125

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit125	b	large	STOCK t¹², STOCK t^w5, STOCK t^w12
Not Specified	D17Mit125	c	smallest	C3H

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit125	a	small	B10.CAS4, C57BL/6, C57BL/10
		b	medium	C3.SW-H2^b
		c	large	B10.CAS3
		d	larger	C3H/HeJ

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit125	a	smallest	A.CA-H2^f/Sn
		b	larger	C57BL/6J, DBA/2J, SM/J
		c	larger than above	CAST/EiJ, SJL/J, SWR/J
		d	larger than above	CBA/J
		e	larger than above	M. spretus
		f	larger than above	RIIIS/J
		g	larger than above	P/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit125	a	144bp	B6.Cg-Lep^ob/+, BALB/cJ
	b	146bp	LP/J
	c	150bp	NON/ShiLt
	d	152bp	A/J, CAST/EiJ
	e	154bp	C3H/HeJ

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23