About   Help   FAQ
D17Mit124 Primer Detail
Primers
  • Name
    D17Mit124
  • Primer 1 Sequence
    TGTTGATGAGATCTTAAATCAGCC
  • Primer 2 Sequence
    TTTTAACTAGTTGTTATTGCATGTGTG
  • ID
    MGI:705092
  • Product Size
    149
  • Other IDs
    D17Mit124 (BROAD)
  • Note
    MIT assay: MT1271
    Additional information: MIT STS Marker Data Files
Genes
D17Mit124 DNA segment, Chr 17, Massachusetts Institute of Technology 124
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit124 a smallest STOCK t12
b large STOCK tw5
c larger C3H, STOCK tw12
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit124 a small C57BL/6, C57BL/10
b medium B10.CAS3, C3.SW-H2b
c large B10.CAS4
d larger C3H/HeJ
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit124 a smallest M. caroli
b larger M. spretus
c larger than above C57BL/6J, P/J, SM/J
d larger than above CAST/EiJ
e larger than above DBA/2J, SJL/J, SWR/J
f larger than above A.CA-H2f/Sn
g larger than above CBA/J
h larger than above RIIIS/J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit124 a 149bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, SPRET/EiJ
b 151bp CAST/EiJ, LP/J
c 153bp BALB/cJ, DBA/2J, NON/ShiLt
d 163bp AKR/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit124 a 163bp AKR/W, C3H/W, CBA/W
b 153bp 129/SvW, A.CA/W, BALB/cW, DBA/2W
c 149bp BN/aW, C57BL/6W, C57BL/10W
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory