D17Mit124 Primer Detail MGI Mouse MGI:705092

D17Mit124 Primer Detail

Name

D17Mit124
Primer 1 Sequence

TGTTGATGAGATCTTAAATCAGCC
Primer 2 Sequence

TTTTAACTAGTTGTTATTGCATGTGTG
ID

MGI:705092
Product Size

149
Other IDs

D17Mit124 (BROAD)
Note

MIT assay: MT1271
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 124

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit124	a	smallest	STOCK t¹²
		b	large	STOCK t^w5
		c	larger	C3H, STOCK t^w12

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit124	a	small	C57BL/6, C57BL/10
		b	medium	B10.CAS3, C3.SW-H2^b
		c	large	B10.CAS4
		d	larger	C3H/HeJ

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit124	a	smallest	M. caroli
		b	larger	M. spretus
		c	larger than above	C57BL/6J, P/J, SM/J
		d	larger than above	CAST/EiJ
		e	larger than above	DBA/2J, SJL/J, SWR/J
		f	larger than above	A.CA-H2^f/Sn
		g	larger than above	CBA/J
		h	larger than above	RIIIS/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit124	a	149bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, SPRET/EiJ
	b	151bp	CAST/EiJ, LP/J
	c	153bp	BALB/cJ, DBA/2J, NON/ShiLt
	d	163bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit124	a	163bp	AKR/W, C3H/W, CBA/W
	b	153bp	129/SvW, A.CA/W, BALB/cW, DBA/2W
	c	149bp	BN/aW, C57BL/6W, C57BL/10W

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24