About   Help   FAQ
D17Mit123 Primer Detail
Primers
  • Name
    D17Mit123
  • Primer 1 Sequence
    CACAAGGAGGGAGCCTGTAG
  • Primer 2 Sequence
    CACCGTAAGAGTCTAATAATAAGGGG
  • ID
    MGI:705091
  • Product Size
    133
  • Other IDs
    D17Mit123 (BROAD)
  • Note
    MIT assay: MT547
    Additional information: MIT STS Marker Data Files
Genes
D17Mit123 DNA segment, Chr 17, Massachusetts Institute of Technology 123
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit123 a 155bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 149bp 129X1/SvJ
c 133, 155bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit123 a 133bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
b 137bp A/J, BALB/cJ
c 155bp AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 165bp CAST/EiJ
e 181bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit123 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit123 b 134bp C57BL/6JOlaHsd, C57BL/10
c 140bp A/JOlaHsd, BALB/cJ
d 154bp 129P3/J, AKR/OlaHsd, C3H/HeJ, DBA/2J
l 150bp SJL/J
p 162bp JF1, PWB
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit123 b smaller C57BL/6J
l larger C57L/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit123 c 152bp CBA/CaOlaHsd
s 147bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit123 a 155bp 129/SvW, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
b 137bp C57BL/10W
c 133bp A.CA/W, BALB/cW, C57BL/6W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory