D3Mit97 Primer Detail MGI Mouse MGI:705083

D3Mit97 Primer Detail

Name

D3Mit97
Primer 1 Sequence

ACTGCATATGTATGTGTGCATG
Primer 2 Sequence

AGAACATGAAATAACCATGAAAAGC
ID

MGI:705083
Product Size

117
Other IDs

D3Mit97 (BROAD)
Note

MIT assay: MPC2312
Additional information: MIT STS Marker Data Files

D3Mit97

DNA segment, Chr 3, Massachusetts Institute of Technology 97

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit97	c	111bp	C3HeB/FeJLe
	D3Mit97	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit97	a	93bp	AKR/J, BALB/cJ, DBA/2J
	b	101bp	LP/J, SPRET/EiJ
	c	107bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	109bp	CAST/EiJ
	e	111bp	A/J, C3H/HeJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24