About   Help   FAQ
D3Mit90 Primer Detail
Primers
  • Name
    D3Mit90
  • Primer 1 Sequence
    AGTTAAATTTCTTTGGTAATTGACACA
  • Primer 2 Sequence
    GTCTCTAATAACCAAAAATGTTTCAA
  • ID
    MGI:705082
  • Product Size
    144
  • Other IDs
    D3Mit90 (BROAD)
  • Note
    MIT assay: MPC281
    Additional information: MIT STS Marker Data Files
Genes
D3Mit90 DNA segment, Chr 3, Massachusetts Institute of Technology 90
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit90 c 145bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit90 a 135bp DBA/2J
b 137bp LP/J
c 139bp A/J, BALB/cJ, CAST/EiJ
d 141bp AKR/J
e 143bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
f 145bp C3H/HeJ
g 165bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory