D3Mit90 Primer Detail MGI Mouse MGI:705082

D3Mit90 Primer Detail

Name

D3Mit90
Primer 1 Sequence

AGTTAAATTTCTTTGGTAATTGACACA
Primer 2 Sequence

GTCTCTAATAACCAAAAATGTTTCAA
ID

MGI:705082
Product Size

144
Other IDs

D3Mit90 (BROAD)
Note

MIT assay: MPC281
Additional information: MIT STS Marker Data Files

D3Mit90

DNA segment, Chr 3, Massachusetts Institute of Technology 90

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit90	c	145bp	C3HeB/FeJLe
	D3Mit90	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit90	a	135bp	DBA/2J
	b	137bp	LP/J
	c	139bp	A/J, BALB/cJ, CAST/EiJ
	d	141bp	AKR/J
	e	143bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	f	145bp	C3H/HeJ
	g	165bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24