D17Mit155 Primer Detail MGI Mouse MGI:705078

D17Mit155 Primer Detail

Name

D17Mit155
Primer 1 Sequence

TGAGAAGGTTGGGTTTATATATTTAGG
Primer 2 Sequence

CGATCATTTCCTTGCAACCT
ID

MGI:705078
Product Size

140
Other IDs

D17Mit155 (BROAD)
Note

MIT assay: MT2750
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 155

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit155	c	158bp	C3HeB/FeJLe
	D17Mit155	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit155	a	128bp	CAST/EiJ
	b	130bp	SPRET/EiJ
	c	134bp	DBA/2J
	d	136bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	e	138bp	NOD/MrkTac, NON/ShiLt
	f	158bp	A/J, AKR/J, C3H/HeJ, LP/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24