About   Help   FAQ
D17Mit155 Primer Detail
Primers
  • Name
    D17Mit155
  • Primer 1 Sequence
    TGAGAAGGTTGGGTTTATATATTTAGG
  • Primer 2 Sequence
    CGATCATTTCCTTGCAACCT
  • ID
    MGI:705078
  • Product Size
    140
  • Other IDs
    D17Mit155 (BROAD)
  • Note
    MIT assay: MT2750
    Additional information: MIT STS Marker Data Files
Genes
D17Mit155 DNA segment, Chr 17, Massachusetts Institute of Technology 155
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit155 c 158bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit155 a 128bp CAST/EiJ
b 130bp SPRET/EiJ
c 134bp DBA/2J
d 136bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 138bp NOD/MrkTac, NON/ShiLt
f 158bp A/J, AKR/J, C3H/HeJ, LP/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory