D3Mit87 Primer Detail MGI Mouse MGI:705075

D3Mit87 Primer Detail

Name

D3Mit87
Primer 1 Sequence

TTTGTGTGGCAATGGCTG
Primer 2 Sequence

TATCCTAAACCAGAAGGTGGTTG
ID

MGI:705075
Product Size

131
Other IDs

D3Mit87 (BROAD)
Note

MIT assay: MPC698
Additional information: MIT STS Marker Data Files

D3Mit87

DNA segment, Chr 3, Massachusetts Institute of Technology 87

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit87	a	130bp	AKR/J, LP/J
	b	132bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	136bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D3Mit87	c	135bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	131bp	C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	j	143bp	JF1
	p	129bp	129P3/J, AKR/OlaHsd, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24