About   Help   FAQ
D2Mit285 Primer Detail
Primers
  • Name
    D2Mit285
  • Primer 1 Sequence
    TCAATCCCTGTCTGTGGTAGG
  • Primer 2 Sequence
    TATGACACTTACAAGGTTTTTGGTG
  • ID
    MGI:705065
  • Product Size
    141
  • Other IDs
    D2Mit285 (BROAD)
  • Note
    MIT assay: MT3015
    Additional information: MIT STS Marker Data Files
Genes
D2Mit285 DNA segment, Chr 2, Massachusetts Institute of Technology 285
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit285 a 152bp 129X1/Sv
f 138, 148bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit285 c 148bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit285 a 96bp SPRET/EiJ
b 118bp CAST/EiJ
c 136bp A/J
d 138bp AKR/J, C57BL/6J, NOD/MrkTac
e 142bp B6.Cg-Lepob/+
f 148bp BALB/cJ, C3H/HeJ
g 152bp DBA/2J
h 154bp NON/ShiLt
i 162bp LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit285 c 143bp CBA/CaOlaHsd
s 152bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit285 a larger 129P3/J
s smaller SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory