D2Mit285 Primer Detail MGI Mouse MGI:705065

D2Mit285 Primer Detail

Name

D2Mit285
Primer 1 Sequence

TCAATCCCTGTCTGTGGTAGG
Primer 2 Sequence

TATGACACTTACAAGGTTTTTGGTG
ID

MGI:705065
Product Size

141
Other IDs

D2Mit285 (BROAD)
Note

MIT assay: MT3015
Additional information: MIT STS Marker Data Files

D2Mit285

DNA segment, Chr 2, Massachusetts Institute of Technology 285

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit285	a	152bp	129X1/Sv
Not Specified	D2Mit285	f	138, 148bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit285	c	148bp	C3HeB/FeJLe
	D2Mit285	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit285	a	96bp	SPRET/EiJ
	b	118bp	CAST/EiJ
	c	136bp	A/J
	d	138bp	AKR/J, C57BL/6J, NOD/MrkTac
	e	142bp	B6.Cg-Lep^ob/+
	f	148bp	BALB/cJ, C3H/HeJ
	g	152bp	DBA/2J
	h	154bp	NON/ShiLt
	i	162bp	LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit285	c	143bp	CBA/CaOlaHsd
	D2Mit285	s	152bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit285	a	larger	129P3/J
	D2Mit285	s	smaller	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23