About   Help   FAQ
D2Mit417 Primer Detail
Primers
  • Name
    D2Mit417
  • Primer 1 Sequence
    GTTCTTATTTTACTGGGGTCATGG
  • Primer 2 Sequence
    TGGGTCACCTTAACAAGAATAATT
  • ID
    MGI:705047
  • Product Size
    122
  • Other IDs
    D2Mit417 (BROAD)
  • Note
    MIT assay: MTH597
    Additional information: MIT STS Marker Data Files
Genes
D2Mit417 DNA segment, Chr 2, Massachusetts Institute of Technology 417
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit417 a 122bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 124bp AKR/J, DBA/2J
c 128bp A/J
d 132bp CAST/EiJ
e 152bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit417 c 121bp 129P3/J, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
d 123bp A/JOlaHsd, AKR/OlaHsd, DBA/2J
j 141bp JF1
p 125bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory