D2Mit417 Primer Detail MGI Mouse MGI:705047

D2Mit417 Primer Detail

Name

D2Mit417
Primer 1 Sequence

GTTCTTATTTTACTGGGGTCATGG
Primer 2 Sequence

TGGGTCACCTTAACAAGAATAATT
ID

MGI:705047
Product Size

122
Other IDs

D2Mit417 (BROAD)
Note

MIT assay: MTH597
Additional information: MIT STS Marker Data Files

D2Mit417

DNA segment, Chr 2, Massachusetts Institute of Technology 417

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit417	a	122bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	124bp	AKR/J, DBA/2J
	c	128bp	A/J
	d	132bp	CAST/EiJ
	e	152bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit417	c	121bp	129P3/J, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
	d	123bp	A/JOlaHsd, AKR/OlaHsd, DBA/2J
	j	141bp	JF1
	p	125bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24