D14Mit40 Primer Detail MGI Mouse MGI:705041

D14Mit40 Primer Detail

Name

D14Mit40
Primer 1 Sequence

TCCCGGGGATCAGTAAAATAT
Primer 2 Sequence

CAAGGTGGCCTCTGACTTTC
ID

MGI:705041
Product Size

182
Note

MIT assay: A1102

D14Mit40

DNA segment, Chr 14, Massachusetts Institute of Technology 40

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit40	m	182bp	MOLF/EiJ
Not Specified	D14Mit40	s	198bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit40	a	174bp	CAST/EiJ
	b	184bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	c	192bp	DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24