D3Mit307 Primer Detail MGI Mouse MGI:705026

D3Mit307 Primer Detail

Name

D3Mit307
Primer 1 Sequence

GAACTTGTAGCAGAAAGAAAGATGG
Primer 2 Sequence

TGGTATTTTAAGAATCGCTCATACA
ID

MGI:705026
Product Size

106
Other IDs

D3Mit307 (BROAD)
Note

MIT assay: MTH1647
Additional information: MIT STS Marker Data Files

D3Mit307

DNA Segment, Chr 3, Massachusetts Institute of Technology 307

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit307	a	75bp	CAST/EiJ
	b	99bp	SPRET/EiJ
	c	101bp	A/J, BALB/cJ, C3H/HeJ
	d	109bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D3Mit307	c	96bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	104bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	j	84bp	JF1
	l	108bp	SJL/J
	p	102bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24