About   Help   FAQ
D3Mit307 Primer Detail
Primers
  • Name
    D3Mit307
  • Primer 1 Sequence
    GAACTTGTAGCAGAAAGAAAGATGG
  • Primer 2 Sequence
    TGGTATTTTAAGAATCGCTCATACA
  • ID
    MGI:705026
  • Product Size
    106
  • Other IDs
    D3Mit307 (BROAD)
  • Note
    MIT assay: MTH1647
    Additional information: MIT STS Marker Data Files
Genes
D3Mit307 DNA Segment, Chr 3, Massachusetts Institute of Technology 307
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit307 a 75bp CAST/EiJ
b 99bp SPRET/EiJ
c 101bp A/J, BALB/cJ, C3H/HeJ
d 109bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit307 c 96bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 104bp 129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
j 84bp JF1
l 108bp SJL/J
p 102bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory